The Effect of miR-34a and miR-34b Polymorphisms on Clinical-Pathological Characteristics of Renal Cell Carcinoma

Document Type : Original Article

Authors

1 Department of urology, Shahid Modarres Hospital, Shahid Beheshti University of Medical Sciences; Tehran, Iran

2 Department of Urology, Zahedan University of Medical Sciences, Zahedan, Iran

3 Urology and Nephrology Research Center, Department of Urology, Shahid Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

4 School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran

5 Student Research Committee, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran

6 Department of Medical Genetics, Afzalipour Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran

10.22034/tru.2022.360598.1125

Abstract

Introduction: MicroRNAs can regulate expression of gene by binding to 3'-UTRs (untranslated region) of mRNAs. Genetic changes in miRNA binding domains affect susceptibility to various diseases, including cancer. This research presented to determine the impact of pri-miR-34b T> C rs4938723 and miR34a A>C rs6577555 polymorphism in renal cell carcinoma.  
Method: This case-control study has been done on 100 patients with RCC and 100 healthy matched control in two referral urology centers in Tehran, Iran. The miRNA-34a/b polymorphisms mentioned in the genomes of healthy individuals and patients with RCC were studied by the tetra arms PCR method. Then statistical studies were performed by SPSS software, using the independent sample T-test and Chi-square. A P-value lower than 0.05 is significant.
Results: The connection between pri-miR-34b T>C and miR34a A>C variants were considered according to age, sex, tumor site, metastasis site, tumor stage, and tumor grade in this study. No statistically significant difference existed between the two study groups regarding gender and age. Smoking and alcohol consumption were significantly higher in RCC patients, so we suggest them as the main risk factors. The rs6577555 polymorphism showed a significant association with the classification of tumor type (P-value=0.047), but rs4938723 SNP did not correlate with the tumor type.    
Conclusions: The findings indicated that rs4938723 and rs6577555 polymorphism might be a risk for predisposition to RCC in the population of Iran. More research with greater sample sizes and various ethnicities must approve our findings.

Highlights

  • Changes in miRNA binding sites or their sequences may affect the interaction of mRNA-miRNA target sites, thus, leading to a change in the regulation of target gene expression.
  • MiRNAs are more powerful biomarkers in the detection of cancers than other molecular biomarkers.
  • Numerous studies have shown the association between cancer risk and miR-SNPs.

Keywords

Main Subjects


Introduction

Renal cell carcinoma (RCC) is a predominant kind of kidney cancer in which malignant cells form in the kidney's tubules. RCCs account for approximately %2 to 3% of all adult malignancies scenarios. It can be classified into three major subgroups, such as a clear cell (ccRCC), chromophobe (chRCC), and papillary (pRCC) (1). People may not be aware of having cancer at all until the cancer is in its later stages. Most cases are diagnosed incidentally on imaging, ultrasound, CT scan, and MRI (2). Kidney cancer survival rates depend heavily on the tumor stage and the treatment selection. Most cases of RCC are detected between 50 and 70 years of age (3, 4).

The usual symptoms of RCC are haematuria, flank pain, unintentional weight loss, loss of appetite, abdominal mass, and abnormal liver function (5). Kidney cancer survival rates depend heavily on the tumor stage and the treatment selection. Nonetheless, the overall patient survival rate is still low (6). The well-established predisposing factors for renal cell carcinoma are hypertension, obesity, family history, cigarette smoking, and aromatic hydrocarbon (6, 7). MiRNAs (MicroRNAs) are the large class of short non-coding RNAs (ncRNA) that span between 18-25nt. Post-transcriptionally, they regulate the multiple genes expression by binding to the mRNA of the coding genes (8, 9).  Early evidence of the role of miRNAs in human cancer was revealed in the pathogenesis of chronic lymphocytic leukaemia (CLL). One of the most common cytogenetic abnormalities observed in more than 80% of B-CLL patients is 13q14.3 deletions.

According to the report, microRNAs have many roles in the biological mechanisms related to tumorigenesis, including apoptosis, stress response, cell-cycle regulation, and Immune response. So, they are promising candidates for biomarker development (10-12). Evidence recommends that miRNAs are abnormally expressed in renal cell carcinoma and have notable parts in malignancies' onset, progression, and metastasis. Any change in miRNA binding sites or their sequences may affect the interaction of mRNA-miRNA target site, thus, leading to a change in the regulation of target gene expression (13).

Several studies have concentrated on the connection between miR-34 family members and tumorigenesis of several malignancies, such as hepatocellular carcinoma (HCC). Xu et al., acknowledged that SNP rs4938723 in the promoter region of pri-miR-34a/b,c may contribute to hepatocellular carcinoma susceptibility (14). In this paper, we investigated whether pri-miR-34b T>C rs4938723 and miR34a A>C rs6577555 polymorphism increase the risk of RCC and affect the outcome of patients with renal cell carcinoma in the Iranian population.

 

Methods

Study subjects and DNA Extraction

This research was performed based on the declaration of Helsinki (IR. SBMU.UNRC.1397.33). Informed written consent was signed by patients. Generally, 100 renal cell carcinoma patients and 100 controls were enrolled in this case-control study. Samples were collected from RCC patients who were treated in Modares and Labbafinejad hospital from September 2016 to September 2020. A total of Peripheral blood samples were gathered in EDTA containers and stored at -80 C° for further molecular analysis. Genomic DNA was extracted from 5ml peripheral blood samples by the salting-out method. The two miRNA SNPs chosen for this paper were pri-miR-34b T>C rs4938723 and miR34a A>C rs6577555. We used Amplification refractory mutation system polymerase reaction chain (T-ARMS- PCR) assays to analyze these SNPs. We also tested the relationship between these polymorphisms and clinicopathologic data, including tumor stage, grade, tumor type, age, gender, lymph-node involvement, distant metastasis, etc. The role of SNP was measured with the comparison of allele frequency of miRNAs in the patient group to that in control groups.   

              

T-ARMS-PCR primers design and genotyping

For genotyping of 200 human samples, T-ARMS-PCR assays were applied. Two missense SNPs, and four pairs of primers were found and designed following the rules (Table 1). The PCR reactions were performed in a total volume of 25μL, containing 10pmol of each of the inner primers, 10pmol of each of the outer primers, 10mM of Amplicon PCR master mix 1×, and 100ng of DNA. An initial denaturation at 95 °C for 5min is used to perform the PCR amplification profile preceded by denaturation at 95 °C for 1min (32 cycles), annealing at 54 °C (32 cycles), and extension at 72 °C for 45min (32 cycles), preceded by the last extension for 5min. The products were detected by electrophoresis in 1.5% agarose gel stained with ethidium bromide at an onstant voltage (100V) for 40min.

 

Table 1. Primer sequences and product size for the T-ARMS-PCR assay of miR-34a and pri-miR-34b gene polymorphisms

SNP

Primer

Sequence 5´ - 3´

PCR product

 

rs4938723

T>C 

Forward inner primer (C allele)

CCTCTGGGAACCTTCTTTGACCTCTC

202

Reverse inner primer (T allele)

AGAAGGGAGGTCCTCAATGAGAGCTTTA

142

Forward outer primer

TCACAAGATACTGTTTTTCTGGCATCCA   

290

Reverse outer primer

TAGTCAAATAGTGAGCCAGGCAGCTTGT

290

rs6577555

A>C

Forward inner primer (A allele)                   

ACCAGCCTGGTTAACATAGCCAGATCA

194

Reverse inner primer (C allele)           

CATTTTGTAGAGACAGTTGCTGAAGGTAGG 

266

Forward outer primer CGTGCCTGTAGTCCTAGCTACTGGAGAG

403

Reverse outer primer   TCAACCACTGTCCTTTTCGAATTTTTTC 640                  

403

 

Statistical analysis

A paired T-test was applied to investigate the differences in levels of miRNAs between patient and control groups. By using the student’s T-test or Chi-square test, differences between the two groups were analyzed. We used Pearson’s correlation coefficient analysis. A P-value<0.05 was considered statistically significant. Many variables were adjusted, including age, gender, drinking status, smoking, and clinicopathological characteristics.

 

Results

Study subject characteristics

In this study, the 100 RCC cases, including 67(50.4%) males and 33(49.3%) females with an overall mean age of 55 ± 12 years, and 100 cases without renal cancer, including 66(49.6%) males and 34 (50.7%)females with an overall mean age of15±51 years, were compared. No statistically significant difference was found between the two study groups regarding age and gender (P-value=0.54 and 0.5, respectively).

Table 2 shows the comparison of subjects with and without RCC based on weight loss, anorexia, positive personal history, positive family history, myalgia smoking, alcohol consumption, and drug use. We identified that smoking, alcohol consumption, and drug use rates were lower in the control group than in the RCC patients’ group, and 27% of all patients had lost weight symptoms, while this number was 9 in the control group.

 

Table 2. Association between RCC and baseline information of patients

Variables

Controls (N:100)

Patients (N:100)

Total

P-value

 

Number (%)

Number (%)

Number (%)

Weight loss

36

27 (27%)

9 (9%)

0.001

Decreased appetite

30

20 (20%)

10 (10%)

0.048

Myalgia

31

21 (21%)

10 (10%)

0.032

Positive Personal history

2

2 (2%)

0 (0%)

0.156

Positive Family history

1

1 (1%)

0 (0%)

0.317

Smoking

28

21 (21%)

7 (7%)

0.004

Opium

11

10 (10%)

1 (1%)

.005

Alcohol consumption

6

6 (6%)

0 (0%)

0.013

 

 

Presence of comorbidities and clinical characteristics

In this study, we compared the number of comorbidities in the patient and control groups with an overall percentage. The prevalence of specific comorbidities in the RCC patients’ group was: diabetes (n=16, 43%), hypertension (n=32, 42.6%), hyperlipidemia (n=12, 34.2%), cardiovascular diseases (n=16, 34.7%) and the prevalence of comorbidities in the control groups was:  diabetes (n=21, 57%), hypertension (n=43, 57.3%), hyperlipidemia (n=23, 65.8%), cardiovascular diseases (n=30, 65.3%). It is essential to note that several patients had more than one comorbidity.

 

Descriptive statistics

We identified differences between groups based on site distribution, clinical/pathological stage, presence of clinical/pathological nodal metastasis, differentiation grade, and lymphatic invasion by histology. The most usual kind of RCC was clear cell type (61%). 61% of the cases were clear cell type, and 13% were mucinous carcinoma. The majority of patients were in the T3 stage (81%), while 27 and 68% showed lymphatic vessel invasion and nodal metastasis, respectively (Table 5).

Data analysis showed that most patients were of clear cell type (61%).40% cases were at T1a stage while 21% of them were at T3a and t1b stage. 59% of cases were right-sided (Table 5). The RCC was located at the lower pole in four out of thirteen patients (30%), at the upper pole in 29% of cases, at the lower-middle and upper-lower-middle in 3% of patients, and in the upper-middle in four cases (4%). The primary tumor location was the middle pole in thirty-one cases (31%) (Table 5). When we analyzed our data, according to Fuhrman nuclear grading system, we found that 19% belongs to grade I, 44% to grade II, 21% to grade III, and 16% to grade IV (Table 3).

 

 

Table 3. Clinical characteristics of RCC cancer cases and controls

Feature

Number

Percentage

Stage

T1aNxMx

34

34

T1bNxMx

16

16

T2NxMx

11

11

T3aNxMx

17

17

T3bN1Mx

7

7

T3bN2Mx

5

5

T3bNxMx

6

6

T4NxMx

4

4

Total

100

100

Tumor type

Papillary type1

10

10

Papillary type2

6

6

Choromophob

12

12

Clear cell

60

60

Rcc oncocytic

2

2

Scc

1

1

Adenocarcinoma

0

0

Rcc unclacified

0

0

Sarcomatoeid

2

2

Conventional

3

3

Celecting duct carcinoma

2

2

Metastatic

1

1

Metanephric stroma

1

1

Total

100

100

Tumor location

Upper pole

29

29

Lower pole

30

30

Middle pole

31

31

Upper-middle

4

4

Lower-middle

3

3

Upper-lower-middle

3

3

Laterality

Right

59

59

Left

41

41

Tumor grade

I

21

21

II

42

42

III

21

21

IV

16

16

 

 

Association of the rs4938723 SNP and rs6577555 SNP with renal cell carcinoma risk

The distributions of genotypes for the miRNA polymorphisms pri-miR-34b T>C rs4938723 and miR34a A>C rs6577555 in RCC patients and control cases are illustrated in Table 4. We observed that pri-miR-34b CC and miR34a CC genotypes were more frequent in both groups, but no statistically significant difference was in the distribution of the other genotypes between RCC cases and the control group.

 

 

Table 4. The distributions of genotypes for the miRNA polymorphisms pri-miR-34b T>C rs4938723 and miR34a A>C rs6577555 in RCC patients and control cases

SNP

Case/Control

TT

CT

CC

rs4938723

T>C

Patients (N: 100)

33 (33%)

45 (45%)

6 (6%)

Controls (N: 100)

42 (42%)

44 (44%)

14 (14%)

Total (N: 200)

75

89

19

P-value

0.189

0.887

0.060

SNP

Case/Control

AA

CA

CC

rs6577555     

A>C

Patients (N: 100)

36 (36%)

41 (41%)

23 (23%)

Controls (N: 100)

43 (43%)

44 (44%)

13 (13%)

Total

79

85

36

P-value

0.312

0.668

0.066

 

 

Subgroup analysis according to RCC subtype

We examined the association of the two miRNA SNPs with each RCC subtype. We observed that rs6577555 polymorphism revealed a significant association with tumor type (P-value=0.047), but rs4938723 SNP was not related to the classification of tumor subtype (P-value=0.42) (Table 5).

 

Table 5. Association of the pri-miR-34b T>C rs4938723 and miR34a A

Tumor type

Rs6577555

Rs4938723

AA

AC

CC

TT

CT

CC

Papillary type1

5

3

2

5

5

0

Papillary type2

2

3

1

0

6

0

Choromophob

2

8

2

2

9

1

Clear cell

17

33

10

27

30

3

RCC oncocytic

0

2

0

0

2

0

Squamous Cell Carcinoma

1

0

0

0

0

1

Adenocarcinoma

0

1

0

0

0

0

RCC unclassified

0

0

0

0

0

0

Sarcomatoid

0

1

1

0

1

1

Conventional

2

1

0

1

2

0

Collecting duct carcinoma

1

1

0

1

1

0

RCC metastatic

1

0

0

0

1

0

Metanephric stromal

1

0

0

1

0

0

Total

32

52

16

37

57

6

 

 

We compared persons with and without RCC based on lymph node involvement, distant metastasis, surgical margin status, perineural invasion, Perivascular invasion, Perirenal Fat Invasion, and adrenal invasion. Rs4938723 polymorphism revealed a remarkable association with perirenal Fat Invasion (P-value=0.020), distant metastasis (P-value=0.03), and lymph node involvement (P-value=0.02) as patients. Rs4938723 polymorphism revealed a significant association with tumor stage (P-value=0.025), but rs6577555 SNP did not relate to the classification of malignant tumors stage (P-value=0.38) (Table 6).

 

 

Table 6. Comparison between gene genotypes and pathological stage

SNP

Pathologic stage

TT

CT

CC

Total

 

 

Rs4938723(P=0.025)

T1a

16

16

8

40

T1bNxMx

5

15

1

21

T2NxMx

5

1

1

7

T3aNxMx

3

11

7

21

T3bNxMx

2

1

2

5

T3bN1Mx

0

1

2

3

T3bN2Mx

2

0

0

2

T4NxMx

0

0

1

1

Total

33

45

22

100

 

 

 

Rs6577555 (p=0.38)

Pathologic stage

AA

AC

CC

Total

T1a

13

19

8

40

T1bNxMx

10

7

4

21

T2NxMx

2

3

2

7

T3aNxMx

8

9

4

21

T3bNxMx

2

1

2

5

T3bN1Mx

0

1

2

3

T3bN2Mx

1

1

0

2

T4NxMx

0

0

1

1

Total

36

41

23

100

 

The results showed a significant connection between the rs4938723 polymorphism and tumor grade of RCC patients (P-value=0.018), but no significant correlation was detected between the pri-miR-34b rs4938723 variant and tumor types (P-value=0.42). Rs6577555 polymorphism revealed a significant correlation with tumor types of RCC subjects (P-value=0.047), but rs6577555 SNP did not associate with their tumor grade of them (P-value=0.11) (Table 7).

 

 

Table 7. Comparison between gene genotypes and tumor grade with RCC tumor type

Polymorphism

Tumor Grade

CC

CT

TT

Total

 

 

Rs4938723

1/4

3

10

6

19

2/4

11

18

15

44

3/4

5

8

8

21

4/4

3

9

4

16

Total

22

45

33

100

 

 

 

Rs6577555

Tumor Grade

AA

AC

CC

Total

1/4

6

6

7

19

2/4

9

19

16

44

3/4

4

11

6

21

4/4

4

5

7

16

Total

23

41

36

100

 

 

Discussion

In This paper, we discovered that rs4938723 in pri-miR-34b and rs6577555 in miR34a were linked to the development of RCC in Iranian population. Both variants did not correlate with age and sex in RCC patients, but pri-miR-34b rs4938723 polymorphism is more frequent in RCC grade 2/4. According to the results, CC genotype for both rs4938723 and rs6577555 is correlated with distant metastasis and lymph node involvement.

MicroRNAs are small groups of ncRNAs that are now recognized as the primary regulator of gene activity. Numerous studies have shown the association between cancer risk and miR-SNPs. when SNPs in miRNA genes could possibly affect miRNA biogenesis and change target selection, much attention has been paid to evaluating the assosiation between the cancer risk and variation in microRNAs (15). MiR-34a and miR-34b are a member of the highly conserved miR-34 family. The mir 34 family, like the let7 family, is one of the leading families of TSmirs families. This family includes three memberes: miR-34a, miR-34b, and miR-34c (16).

A study by Zhang S and colleagues showed that miR-34 rs4938723 is a potentially functional variation in the promoter area associated with RCC risk in a Chinese population (17). A meta-analysis study indicated the association between microRNA-34b/c rs4938723 polymorphism and risk for cancer development (18). Another meta-analysis highlighted that hsa-miR-34b/c rs4938723 polymorphism might have a contradictory role in various malignancies (19). A study by Wang X. et al., showed a remarkable connection between the rs4938723 polymorphism and cancer risk in the codominant model of various cancer types, such as osteosarcoma, nasopharyngeal cancer, and kidney cancer (20).  

A study by Yan Sun et al., was conducted to investigate the association of SNPs in the hsa-miR-34a regulatory region with diabetes mellitus (DM) or diabetic nephropathy (DN) susceptibility. Three SNPs (rs12128240, rs2666433, rs6577555) in miR-34a were analyzed in Type 2 diabetes mellitus (T2DM) patients with or without DN and normal controls (21). A study by Zhang S and colleagues revealed no significant association between rs12128240 or rs6577555 and ischemic stroke (IS) found in the Chinese population (22).

Several studies indicate the role of hsa-miR-34a polymorphism in different malignancies, both in tumor formation and poor prognosis of patients (23, 24).  Several studies indicate the role of hsa-miR-34a polymorphism in different malignancies, both in tumor formation and poor prognosis of patients (24). Both Mutations in the P53 gene and deletion of the short arm of chromosome 1 are connected to lower levels of miR-34a. MiR-34a plays as a TSmir and physically affects the proto-oncogene MET and targets its function In head and neck squamous cell carcinoma (HNSCC) (23).

 

Conclusion 

This study aimed to determine signature of miRNA that could recognize RCC blood serum of patients and healthy controls and confirm distinguished miRNAs as potential biomarkers for RCC. The results of these studies identified that pri-miR-34b T>C rs4938723 and miR34a A>C rs6577555 polymorphisms helped predict the severity of kidney cancer as well as patients’ survival rate and might be used in the future as diagnostic biomarkers or targets for treatment that require observations. To approve our findings, greater sample sizes and various ethnicities are required in future studies.

 

Declarations

Author’s contributions

All authors contribute equally.

 

Acknowledgment

Special thanks to the Department of Urology, Zahedan University of Medical Sciences, Zahedan, Iran.

 

Conflict of interest

The authors have no conflicts of interest to declare.

 

Funding

There is no funding.

 

Ethics statement

This research was performed under the declaration of Helsinki (IR. SBMU.UNRC.1397.33). Participants provided informed written consent to participate in the study.

 

Data availability

Data will be provided on request.

 

Abbreviations 

Arms PCR        Amplification refractory mutation system polymerase reaction chain

CLL                  Chronic lymphocytic leukaemia

DM                   Diabetes mellitus

DN                    Diabetic nephropathy

HCC                 Hepatocellular carcinoma

HNSCC            Head and neck squamous cell carcinoma

IS                     Ischemic stroke

MiRNA              Micro RNA

RCC                 Renal Cell Carcinoma

SNP                 Single nucleotide polymorphism

T2DM               Type 2 diabetes mellitus

  1. Srigley JR, Delahunt B, Eble JN, Egevad L, Epstein JI, Grignon D, et al. The International Society of Urological Pathology (ISUP) Vancouver Classification of Renal Neoplasia. Am J Surg Pathol. 2013;37(10):1469-89.
  2. van Oostenbrugge TJ, Fütterer JJ, Mulders PFA. Diagnostic Imaging for Solid Renal Tumors: A Pictorial Review. Kidney Cancer. 2018;2(2):79-93.
  3. Maher ER. Hereditary renal cell carcinoma syndromes: diagnosis, surveillance and management. World J Urol. 2018;36(12):1891-8.
  4. Ansari Djafari A, Javanmard B, Hojjati SA, Faraji S, Garousi M, Bahremand S, et al. Risk Factors and Histopathological Features of Renal Cell Carcinoma Subtypes. Translational Research in Urology. 2022;4(4):167-72.
  5. Pimienta AL, Billings TA, Fish RG. Paraneoplastic Phenomena in a Patient With Locally Destructive and Metastatic Renal Cell Carcinoma. J Prim Care Community Health. 2018;9:2150132718799023.
  6. Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L, Schmidinger M, et al. Renal cell carcinoma. Nat Rev Dis Primers. 2017;3:17009.
  7. Karami S, Boffetta P, Brennan P, Stewart PA, Zaridze D, Matveev V, et al. Renal cancer risk and occupational exposure to polycyclic aromatic hydrocarbons and plastics. J Occup Environ Med. 2011;53(2):218-23.
  8. Meo AD, Wang C, Cheng Y, Diamandis EP, Yousef GM. The miRNA-kallikrein interaction: a mosaic of epigenetic regulation in cancer. Biological Chemistry. 2018;399(9):973-82.
  9. Azodian Ghajar H, Koohi Ortakand R. The Promising Role of MicroRNAs, Long Non-Coding RNAs and Circular RNAs in Urological Malignancies. Translational Research in Urology. 2022;4(1):9-23.
  10. Di Leva G, Garofalo M, Croce CM. MicroRNAs in cancer. Annual review of pathology. 2014;9:287-314.
  11. Aghamir SMK, Nasir Shirazi M, Khatami F. A Systematic Review of Circulating Tumor Cells in Renal Cell Carcinoma. Translational Research In Urology. 2021;3(1):10-8.
  12. Aghamir SMK, Heshmat R, Ebrahimi M, Ketabchi SE, Dizaji SP, Khatami F. The impact of succinate dehydrogenase gene (SDH) mutations in renal cell carcinoma (RCC): A systematic review. OncoTargets and therapy. 2019;12:7929.
  13. Spadaccino F, Gigante M, Netti GS, Rocchetti MT, Franzin R, Gesualdo L, et al. The Ambivalent Role of miRNAs in Carcinogenesis: Involvement in Renal Cell Carcinoma and Their Clinical Applications. Pharmaceuticals (Basel, Switzerland). 2021;14(4).
  14. Son MS, Jang MJ, Jeon YJ, Kim WH, Kwon C-I, Ko KH, et al. Promoter polymorphisms of pri-miR-34b/c are associated with hepatocellular carcinoma. Gene. 2013;524(2):156-60.
  15. Peterson S, Thompson J, Ufkin M, Sathyanarayana P, Liaw L, Congdon CB. Common features of microRNA target prediction tools. Frontiers in Genetics. 2014;5.
  16. Misso G, Di Martino MT, De Rosa G, Farooqi AA, Lombardi A, Campani V, et al. Mir-34: a new weapon against cancer? Mol Ther Nucleic Acids. 2014;3(9):e194.
  17. Zhang S, Qian J, Cao Q, Li P, Wang M, Wang J, et al. A potentially functional polymorphism in the promoter region of miR-34b/c is associated with renal cell cancer risk in a Chinese population. Mutagenesis. 2014;29(2):149-54.
  18. Li H, Diao S, Li J, Ma B, Yuan S. An updated meta-analysis of 23 case-control studies on the association between miR-34b/c polymorphism and cancer risk. Oncotarget. 2017;8(17):28888-96.
  19. Tao T, Chen S, Xu B, Liu C, Wang Y, Huang Y, et al. Association between hsa-miR-34b/c rs4938723 T > C promoter polymorphism and cancer risk: a meta-analysis based on 6,036 cases and 6,204 controls. Chinese Journal of Cancer Research. 2014;26(3):315-22.
  20. Wang X, Lu X, Fang Y, Chen H, Deng X, Peng C, et al. Association between miR34b/c polymorphism rs4938723 and cancer risk: a meta-analysis of 11 studies including 6169 cases and 6337 controls. Medical science monitor: international medical journal of experimental and clinical research. 2014;20:1977.
  21. Sun Y, Peng R, Li A, Zhang L, Liu H, Peng H, et al. Sequence variation in microRNA-34a is associated with diabetes mellitus susceptibility in a southwest Chinese Han population. International journal of clinical and experimental pathology. 2018;11(3):1637-44.
  22. Wei GJ, Yuan MQ, Jiang LH, Lu YL, Liu CH, Luo HC, et al. A Genetic Variant of miR-34a Contributes to Susceptibility of Ischemic Stroke Among Chinese Population. Frontiers in physiology. 2019;10:432.
  23. Hashemi M, Danesh H, Bizhani F, Narouie B, Sotoudeh M, Nouralizadeh A, et al. Pri-miR-34b/c rs4938723 polymorphism increased the risk of prostate cancer. Cancer Biomarkers. 2017;18(2):155-9.
  24. Hashemi M, Hasanpour V, Danesh H, Bizhani F, Narouie B. Association between Pri-miR-34b/c rs4938723 polymorphism and bladder cancer risk. Journal of Biomedical Research. 2019;33(1):24.
Volume 4, Issue 4
November 2022
Pages 187-194
  • Receive Date: 05 September 2022
  • Revise Date: 15 November 2022
  • Accept Date: 20 November 2022
  • First Publish Date: 20 November 2022